Schedl Lab

Washington University Genetics

Additional Methods and Materials

Methods and Materials

Cytosol extracts and immunoprecipitation

Polyclonal anti-GLD-1 antibodies (Ab) have been generated (Jones et al. 1996), but they recognize the conserved GSG domain (data not shown) and therefore may disrupt interactions between GLD-1 and target RNAs. Instead, functional GLD-1 for IP was obtained from a transgenic strain in which the gld-1(q485) null mutant was rescued by an extrachromosomal array (ozEx40) containing wild-type GLD-1 with the FLAG epitope placed at the C-terminus (GLD-1/FLAG), distant from the RNA binding domain.

Cytosol extracts were prepared from roughly synchronized young adult hermaphrodites from the following strains; wild-type, gld-1(q485); ozEx40, gld-1(q361); ozEx40 and gld-1 (q126/q485) female/male, all of which were grown in liquid culture. Bleach synchronized cultures were harvested and washed two times with cold 100 mM NaCl. The floating worms were collected into cold H2O after 30% sucrose cushion centrifugation and washed two times with homogenization buffer (HB, 15 mM Hepes pH 7.6, 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EDTA, 0.5 mM EGTA, 44 mM Sucrose) , which was treated with 0.1% diethylpyrocarbonate. The worm pellet was resuspended in 4x volume HB with 1 mM DTT, 4 mM NaF, 3 mM Na2VO4, and protease inhibitors (Roche) without glycerol for the extracts to be used in immunoprecipitation or with glycerol (final 15%) for the extracts to be used in RNA binding analysis. Worms were then broken into several pieces after passing twice through a small chilled French press at 4000 psi . The carcasses were removed by centrifugation at 200 xg for 2 min. The supernatant was transferred into a dounce homogenizer and stroked 25 times with a B pestle. The nuclei were spun down at 800 xg for 5 min. The supernatant was collected and spun at 14,000 xg for 20 min to clear the lysate. The cleared lysates were collected and adjusted for salt concentration by adding 1/10th volume of 15 mM Hepes pH 7.6, 1.0 M NaCl. This was the working cytosol extract. The cytosol extracts were subjected to immunoprecipitation immediately after isolation to minimize RNA degradation. The extracts used in RNA binding analyses were aliquoted and frozen at -70oC.

For each immunoprecipitation, 10 – 12 ml of cytosol extract (~10 mg/ml) from gld-1(q485); ozEx40 was first preincubated with mouse IgG chemically coupled to protein G-Sepharose (Sigma) for 10 min at 4oC to preabsorb the nonspecific binders. The preabsorded extract was divided into two and incubated with mouse IgG or with Anti-FLAG Ab M2 (Sigma) chemically coupled to protein G-Sepharose for 1 – 1.5 hr at 4oC. The beads were washed 4 times with IP buffer (HB + 100 mM NaCl). After the final wash, the beads were eluted 5 times with the same bead volume of Elution buffer (IP buffer + 200 ug/ml FLAG peptide). 1/20th of each elution volume (E1 to E5) was mixed and boiled with SDS sample buffer for western analysis with anti-GLD-1 Ab ; the remaining material from fractions that contain GLD-1/FLAG were pooled and extracted with phenol/chloroform to isolate RNAs. The typical yield of RNA was approximately 100 ng for both IgG IP and FLAG IP.

cDNA synthesis and subtractive hybridization

RNAs, which were coimmunoprecipitated and coeluted in three independent immunoprecipitations, were combined and 2/3 of them were converted into cDNAs (IgG cDNA and FLAG cDNA) using the protocol of SMART PCR cDNA Synthesis from Clontech. The average length of the cDNAs was about 800 bp. The ends of both IgG cDNA and FLAG cDNA were made blunt by treatment with T4 DNA polymerase, ligated with EcoRI adaptors, cloned into EcoRI digested pBS-KS, and transformed into E.coli. Transformants were selected and grown in 96 well format. PCR was performed to amplify inserts directly from each culture using M13(-40) and Rev primers. Amplified inserts were then subjected to restriction enzyme digest mapping with AluI. After mapping, clones that had different digestion patterns were subjected to sequencing analysis.

Two independent subtractive hybridizations were performed essentially following Diatchenko et al., 1999, using IgG cDNA as the driver and FLAG cDNA as the tester. DNA oligos (see SMART PCR cDNA Synthesis protocol and Diatchenko et al., 1999) used in cDNA synthesis and subtractive hybridization, except PCR primers, were purified using 10% polyacrylamide gel electrophoresis (PAGE). After subtractive hybridization, the remaining cDNAs were amplified by suppression PCR to minimize a preferential amplification of abundant cDNAs . Amplified cDNAs were then digested with RsaI, cloned into SmaI digested pBS-KS, and transformed into E.coli. Transformants were selected and grown in 96 well format. PCR was performed to amplify inserts directly from the culture using the M13(-40) and Rev primers. Amplified inserts were then subjected to sequencing analysis. Almost all the clones that encompass more than 2 exons have the same exon/intron structure as the “Gene Finder” predictions (see http://www.wormbase.org) with a few minor differences (data not shown).

RT-PCR

The remaining 1/3 of RNAs from IgG IP, FLAG IP, 1ug of total RNA from wild-type adult hermaphrodite, and 1ug of total RNA from glp-1(q175) adult hermaphrodite were converted into first strand cDNAs using the 3′-RACE primer (GCGGGATCCTCGAGAAGCTTTTTTTTTTTT) and Superscript II (Lifetech), extracted with phenol/chloroform, precipitated with ethanol, and resuspended in 200 ul TE pH 8.0. One to 3ul of the first strand cDNAs was used as a template for PCR with target gene specific primers and the 3í-anchor primer (GCGGGATCCTCGAGAAGCTT). Sequences of gene specific primers are listed below. Another independent immunoprecipitation was performed and a second set of first strand cDNA was made to reconfirm the RT-PCR data, which was basically identical between the first and the second sets. The 3í-ends were determined by sequencing the RT-PCR product.

Gonad dissection, RNA in situ hybridization and antibody staining

Dissected gonads from L4 and adult hermaphrodites were prepared as described . For RNA in situ hybridization, dissected gonads were fixed in 0.25% glutaraldehyde / 3% formaldehyde, 100mM K2HPO4, pH 7.2, and processed as described . Sense- and anti-sense DNA probes were synthesized with digoxigenin-11-dUTP by repeated primer extension . A control sense probe gave little or no signal (data not shown). For antibody staining, dissected gonads were fixed with cold (-20oC) 100% methanol for 5 min for co-staining with anti-GLD-1 Ab and anti-RME-2 Ab (gift from Barth Grant and David Hirsh) or with 3% formaldehyde, 100mM K2HPO4, pH 7.2 for 1 hr and post-fixed with cold (-20oC) 100% methanol for 5 min for anti-RME-2 Ab . Antibody incubations and washes were performed as described . Affinity purified rabbit polyclonal anti-RME-2 Ab was used at 1:100 dilution and rat polyclonal anti-GLD-1 Ab at 1:20 dilution. A Zeiss Axioplan 2 microscope equipped with a SPOT digital CCD camera (Diagnostic Instruments) was used to capture bright field color images. Epifluorescent images were captured with a Zeiss Axioskop microscope equipped with Hamamatsu digital CCD camera (Hamamatsu Photonics). All images were processed with Adobe Photoshop 5.5 (Adobe).

Molecular cloning and RNA probes

The nucleotide (nt) numbering is based on the full length rme-2 cDNA sequence (GenBank Accession number is AF185706). yk8d2, which is nearly a full length rme-2 cDNA (nt 154 – 2896) was digested with NdeI and re-ligated (pMHL08), resulting in nt 154 – 248 with 2480-2896. The 5′-end of rme-2 was PCR amplified from genomic DNA and cloned into pMHL08 that was digested with SacII and NdeI, resulting in nt 1 – 248 with 2480-2896 (pMHL16). Full length rme-2 cDNA (pMHL 29) was constructed by cloning a PCR product that contains 5′-end into yk8d2 that was digested SacII (pMHL29). pMHL08 was digested with SacII and NdeI, end-filled with T4 DNA polymerase, and self-ligated, resulting in nt 2480 – 2896 (pMHL18). pMHL08 was digested with SacII and EcoRI, end-filled with T4 DNA polymerase, and self-ligated, resulting in nt 2813 – 2896 (pMHL19). Nucleotides 2813 – 2896 of rme-2 cDNA with TTT (2859 – 2861) to GGG substitutions was amplified by sewing PCR from pMHL19 and cloned into pBS-SK that was digested with SacI and KpnI, resulting in nt 2813 – 2896 containing the GGG substitutions (pMHL36). Nearby TTT (nt 2869 – 2871) was substituted with GGG by sewing PCR (pMHL37), or all six T (2859 – 2861 & 2869 – 2871) were substituted with G (pMHL38), resulting in nt 2813 – 2896 containing the above substitutions. yk8d2 was digested with HindIII and self-ligated, resulting in nt 154 – 270 with 2186 – 2896 (pMHL09). 0.75 kb and 1.1 kb HindIII fragments or rme-2 cDNA were cloned into pBS-KS that was digested with HindIII, resulting in nt 264 – 1024 (pMHL10) and nt 1018 – 2191 (pMHL11), respectively. Nucleotides 51 – 100 of rme-2 cDNA were PCR amplified from pMHL16 and cloned into pMHL08 that was digested with SacII and EcoRI, resulting in nt 51 – 100 with 2812 – 2896 (pMHL33). Nucleotides 51 – 100 of rme-2 cDNA with TTT (71 – 73) to GGG substitutions were amplified by sewing PCR from pMHL16 and cloned into pMHL08 that was digested with SacII and EcoRI, resulting in nt 51 – 100 with 2812 – 2896 containing the above substitutions (pMHL34).

The RNA molecules used to define the GLD-1 binding region in Figure 5 are; Probe 1; 1- 248::2480-2896, Probe 2; 264 – 1024, Probe 3; 1018 – 2191, Probe 4; 154 – 270::2185 – 2809 (154 – 270 not drawn in the diagram A)), Probe 5; 1- 248::2480-2809, Probe 6; 154 – 248::2480 – 2809, Probe 7; 1- 100, Probe 8; 1-50, Probe 9; 51 – 100, Probe 10; 2480 – 2809, Probe 11; 2813 – 2896. Probe 1 AS and Probe 11 AS are anti-sense probes of Probe 1 and Probe 11, respectively. Probe 9M1 is the same as Probe 9 except TTT (71 – 73) to GGG substitution. Probe 11M1 is the same as Probe 11 except TTT (2859 – 2861) to GGG substitution. Probe 11M2; TTT (2869 – 2871) to GGG. Probe 11M3 has all 6 T to G substitutions. Wild-type tra-2 3′-UTR (tra-2 WT) and tra-2 (e2020) 3′-UTR (tra-2 e2020) probes are described in Goodwin et al., 1993.

Biotin-RNA pull down assay

For tra-2 WT, tra-2 e2020 , and rme-2 Probes 1 (pMHL16), 2 (pMHL10), 3 (pMHL11),11 (pMHL19), 11M1 (pMHL36), 11M2 (pMHL38), and 11M3 (pMHL39), template DNAs for the biotin RNA synthesis were amplified by PCR using M13(-40) and Rev primers and clones indicated inside parentheses as templates. For Probes 4 (pMHL09), 5 (pMHL16), 6 (pMHL08), and 10 (pMHL18), Rev and 3′-antisense (nt 2809 – 2790) primers were used. For Probes 7 and 8, Rev and 3′-antisense (nt 100 – 81) or (nt 50 – 31) primers, respectively, and pMHL16 as the PCR template were used. For Probes 9 (pMHL33) and 9M1 (pMHL34), Rev and 3′-antisense (nt 100 – 81) primers were used. Biotin-RNAs were synthesized from PCR products that have either T3, or T7 primer sites with biotin RNA labeling mix (Roche) and T3 or T7 RNA polymerase at 37 oC for 2 hrs . Template DNAs were then removed by incubating with 10 U RNAse free DNAse at 37 oC for 15 min and biotin-RNAs were purified through Sephadex G-50 quick spin column (Roche). The integrity of each biotin-RNA was measured in 1.5 % agarose gels. 400 ng of biotin-RNA was incubated with cytosol extracts in 5mM Hepes (pH7.6), 1mM MgCl2, 75mM KCl, 1mM DTT, 1% glycerol, 400 ug/ml tRNA, 6mg/ml Heparin, and 10 units of RNase Inhibitor in a final volume of 50 ul for 20 min at room temperature (RT). For each binding reaction, 100 ul of Streptavidin-magnetic beads (Promega) was first washed in IP buffer with 20 ug/ml tRNA, then resuspended in 15 ul of IP buffer with 20 ug/ml tRNA. The resuspended beads were added to each binding reaction and incubated for 20 min at RT. The magnetic beads were then isolated, washed 4 times with IP buffer with 20 ug/ml tRNA, then boiled in SDS sample buffer. The supernatants were resolved in 10 % SDS-PAGE (acrylamide /bis-acrylamide is 100/1) and subjected to Western analysis with anti-GLD-1 Ab.

Note that since only about 20% of the progeny segregating from gld-1(q361); ozEx40 animals are rescued and they express GLD-1/FLAG at ~1/4th the level of GLD-1 in wild-type, cytosol extracts from gld-1(q361); ozEx40 has GLD-1(q361; Gly 227 Asp) at >20x the level of GLD-1/FLAG.

UV crosslinking

32P labeled RNAs were synthesized from PCR products that have a T3 primer site with [a-32P] UTP (ICN) and T3 RNA polymerase at 37 oC for 2 hrs. Template DNAs were then removed by incubating with 10 U RNAse free DNAse at 37 oC for 15 min and 32P labeled RNAs were purified through Sephadex G-50 quick spin column (Roche). 105 cpm of RNA was incubated with cytosol extracts in 5mM Hepes (pH7.6), 1mM MgCl2, 75mM KCl, 1mM DTT, 1% glycerol, 300 ug/ml tRNA, 3mg/ml Heparin in a final volume of 30ul for 20 min at RT and UV-crosslinked in a Stratalinker UV Crosslinker 2400 (Strategene) at maximum output for 10 min on ice. 80 ug RNAse A was then added and incubated for 20 min at RT to digest any unlinked RNA. After digestion, 70 ul of IP buffer was added and GLD-1 was immunoprecipitated with anti-GLD-1 Ab or rabbit IgG bound to protein G-Sepharose (Sigma) for 1hr at 4oC. The beads were then isolated, washed 4 times with IP buffer, and boiled in SDS sample buffer. The supernatant was resolved in 10% SDS-PAGE (acrylamide /bis-acrylamide is 100/1), dried, and exposed to X-OMAT film (Kodak).

Gene specific primers

mRNA Targets Primer Sequence
Mito. RNA Mito.P1 GTATACCAGTTATTTCAATGAG
ncc-1 (T05G5.3) cdc2-800 CGTGAGAATTTCCTCCGTGAC
T05G5.7 T05G5.7_P1 GGACATGCTCGACAAGGCTC
cej-1 (C07G2.1) C07G2.1_P1 CGGATACGAGTCAGAAGTCG
B0280.5 B0280.5_P1 GATGAGACTCCAATTGCTGC
F26D10.10 F26D10.10_P1 GACAATCTTCGACGCCTCAC
H02I12.5 H02I12.5_P1 CATCGAATTGGAGCAAACGGT
lin-45 (Y73B6A.5) lin45_P2 CCAGTCGAAGAATAATCTCGC
R09B3.1 R09B3.1_P1 CACAGATCAAGAACGTGGATG
rme-2 (T11F8.3) T11F8.3_P1 CGGAATTATTGCCTTCCTTTG
B0244.8 B0244.8_P1 CGTAAAGTCTGCGATGGAACA
T23G11.2 T23G11.2_P1 CTGAAACTTCTGGAGCAACTC
Y75B12B.1 Y75B12B.1_P1 GCTGAAGATGTGCAAATTCGG
puf-5 (F54C9.8) F54C9.8_P1 GGAACTATGTCGTCCAACAG
puf-6/-7/-10 F18A11.1_P1 CTGCTTCTCTACTCTGGATG

References cited

Diatchenko, L., Lukyanov, S., Lau, Y. F., and Siebert, P. D. (1999). Suppression subtractive hybridization: a versatile method for identifying differentially expressed genes. Methods Enzymol 303, 349-80.

Francis, R., Barton, M. K., Kimble, J., and Schedl, T. (1995a). gld-1, a tumor suppressor gene required for oocyte development in Caenorhabditis elegans. Genetics 139, 607-630.

Goodwin, E. B., Okkema, P. G., Evans, T. C., and Kimble, J. (1993). Translational regulation of tra-2 by its 3′ untranslated region controls sexual identity in C. elegans. Cell 75, 329-339.

Grant, B., and Hirsh, D. (1999). Receptor-mediated endocytosis in the Caenorhabditis elegans oocyte. Mol Biol Cell 10, 4311-26.

Jones, A. R., Francis, R., and Schedl, T. (1996). GLD-1, a cytoplasmic protein essential for oocyte differentiation, shows stage-and sex-specific expression during Caenorhabditis elegans germline development. Dev. Biol. 180, 165-183.

Lichtsteiner, S., and Tjian, R. (1995). Synergistic activation of transcription by UNC-86 and MEC-3 in Caenorhabditis elegans embryo extracts. Embo J 14, 3937-45.

Nabel-Rosen, H., Dorevitch, N., Reuveny, A., and Volk, T. (1999). The balance between two isoforms of the Drosophila RNA-binding protein how controls tendon cell differentiation. Mol Cell 4, 573-584.

Seydoux, G., and Fire, A. (1994). Soma-germline asymmetry in the distributions of embryonic RNAs in Caenorhabditis elegans. Development 120, 2823-2834.

Thomas, J. D., Conrad, R. C., and Blumenthal, T. (1988). The C. elegans trans-spliced leader RNA is bound to Sm and has a trimethylguanosine cap. Cell 54, 533-9.

  • Tim Schedl, Ph.D
    Department of Genetics
    Campus Box #8232
    Washington University School of Medicine
    4566 Scott Ave.
    St. Louis, MO 63110

    Contact

    Email: ts@genetics.wustl.edu
    PHONE: (314)362-6164 [lab]
    FAX: (314)362-7855